ID: 1101910463_1101910484

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1101910463 1101910484
Species Human (GRCh38) Human (GRCh38)
Location 12:108857340-108857362 12:108857389-108857411
Sequence CCCCTGCCCCGCACGCGCGGCCC CCGGCGGCCCAGGCCGGGCGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 39, 4: 370} {0: 1, 1: 0, 2: 3, 3: 56, 4: 563}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!