ID: 1101910474_1101910481

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1101910474 1101910481
Species Human (GRCh38) Human (GRCh38)
Location 12:108857362-108857384 12:108857383-108857405
Sequence CCAGCTCCGGCGGCCTCGGCGCG CGGCGTCCGGCGGCCCAGGCCGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 2, 3: 30, 4: 178} {0: 1, 1: 0, 2: 1, 3: 20, 4: 219}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!