ID: 1101919787_1101919797

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1101919787 1101919797
Species Human (GRCh38) Human (GRCh38)
Location 12:108923129-108923151 12:108923173-108923195
Sequence CCATGATCCCCACTTCCTGGTAG TCCCCTTGATTGTGTAGATGGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 7, 3: 36, 4: 281} {0: 1, 1: 0, 2: 0, 3: 15, 4: 180}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!