ID: 1101921519_1101921520

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1101921519 1101921520
Species Human (GRCh38) Human (GRCh38)
Location 12:108937034-108937056 12:108937057-108937079
Sequence CCTGCACGGTGATTAAAAGCAGT CAAGTTAAAGAAAAAGATGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 0, 4: 81} {0: 1, 1: 0, 2: 4, 3: 84, 4: 959}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!