ID: 1101946738_1101946745

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1101946738 1101946745
Species Human (GRCh38) Human (GRCh38)
Location 12:109143129-109143151 12:109143159-109143181
Sequence CCTTCCCCTCTCTGAGTCTCCAA TCTTTAGAATGAGGAGGCTGAGG
Strand - +
Off-target summary {0: 1, 1: 11, 2: 57, 3: 205, 4: 875} {0: 1, 1: 1, 2: 3, 3: 71, 4: 813}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!