ID: 1101958983_1101958993

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1101958983 1101958993
Species Human (GRCh38) Human (GRCh38)
Location 12:109233954-109233976 12:109234005-109234027
Sequence CCATCCACATTCTGAATGTGTCC AGGCACTGGTGCCGATTTTACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 214} {0: 1, 1: 0, 2: 1, 3: 15, 4: 154}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!