ID: 1101967603_1101967609

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1101967603 1101967609
Species Human (GRCh38) Human (GRCh38)
Location 12:109291933-109291955 12:109291947-109291969
Sequence CCTCCGGCCGCCACCCCTCCGGC CCCTCCGGCTGCCACCCCTCCGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 5, 3: 45, 4: 488} {0: 1, 1: 2, 2: 1, 3: 27, 4: 276}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!