ID: 1101996342_1101996350

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1101996342 1101996350
Species Human (GRCh38) Human (GRCh38)
Location 12:109527920-109527942 12:109527940-109527962
Sequence CCCCCTGAGAGGACACGCATTGC TGCCAGGTGTTGCAGCTTGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 54} {0: 1, 1: 0, 2: 0, 3: 23, 4: 225}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!