ID: 1102006981_1102006988

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1102006981 1102006988
Species Human (GRCh38) Human (GRCh38)
Location 12:109595406-109595428 12:109595421-109595443
Sequence CCTAGAGAGCCTGGTGCAGGGCT GCAGGGCTGGGCTGTGGCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 42, 4: 308} {0: 1, 1: 0, 2: 21, 3: 196, 4: 1276}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!