ID: 1102006981_1102006989

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1102006981 1102006989
Species Human (GRCh38) Human (GRCh38)
Location 12:109595406-109595428 12:109595434-109595456
Sequence CCTAGAGAGCCTGGTGCAGGGCT GTGGCTGGGGCTCCTGTCATCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 42, 4: 308} {0: 1, 1: 0, 2: 1, 3: 14, 4: 260}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!