ID: 1102007399_1102007404

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1102007399 1102007404
Species Human (GRCh38) Human (GRCh38)
Location 12:109597321-109597343 12:109597334-109597356
Sequence CCTCCATGGAGCTCTTCAGCAAT CTTCAGCAATGGAGGGAAATAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 141} {0: 1, 1: 0, 2: 1, 3: 25, 4: 221}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!