ID: 1102022201_1102022210

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1102022201 1102022210
Species Human (GRCh38) Human (GRCh38)
Location 12:109691442-109691464 12:109691488-109691510
Sequence CCTCAGCCTCCCAAAGTGCTGGG CTGGCCTATTTGTTTTGAGATGG
Strand - +
Off-target summary {0: 84408, 1: 206434, 2: 234764, 3: 261333, 4: 299516} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!