ID: 1102025283_1102025290

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1102025283 1102025290
Species Human (GRCh38) Human (GRCh38)
Location 12:109711150-109711172 12:109711170-109711192
Sequence CCTCAGGGCCTGTCGGACCCCTG CTGGCCAGAGCCAGTGTTCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 250} {0: 1, 1: 1, 2: 3, 3: 71, 4: 1420}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!