ID: 1102026312_1102026324

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1102026312 1102026324
Species Human (GRCh38) Human (GRCh38)
Location 12:109715808-109715830 12:109715843-109715865
Sequence CCCCACCATGTACCCAGCTGGCA CAGGGTCCCCAGAGAGATGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 15, 4: 166} {0: 1, 1: 0, 2: 1, 3: 30, 4: 281}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!