ID: 1102031933_1102031940

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1102031933 1102031940
Species Human (GRCh38) Human (GRCh38)
Location 12:109744603-109744625 12:109744633-109744655
Sequence CCCGCTTGAGGCCCATGAGCTGT TGGGTGTTTCCTTCCCTCTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 133} {0: 1, 1: 1, 2: 3, 3: 26, 4: 329}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!