ID: 1102033931_1102033938

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1102033931 1102033938
Species Human (GRCh38) Human (GRCh38)
Location 12:109760327-109760349 12:109760346-109760368
Sequence CCCTAAAGGACCAGTGAGGCTCC CTCCGGTTATGGAGGAAAGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 97} {0: 1, 1: 0, 2: 0, 3: 10, 4: 85}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!