ID: 1102061345_1102061351

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1102061345 1102061351
Species Human (GRCh38) Human (GRCh38)
Location 12:109934178-109934200 12:109934217-109934239
Sequence CCTTCATGAAGGGGCTAGGGCTG CCACACCACCAGAGGGCACATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 191} {0: 1, 1: 1, 2: 0, 3: 23, 4: 204}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!