|
Left Crispr |
Right Crispr |
| Crispr ID |
1102074060 |
1102074062 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
12:110045952-110045974
|
12:110045992-110046014
|
| Sequence |
CCATATAAAAAATAATAATAAAA |
GCTTAAAACCATGAGTTGTTAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 3, 1: 20, 2: 271, 3: 2160, 4: 12665} |
{0: 1, 1: 0, 2: 2, 3: 17, 4: 180} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|