ID: 1102090360_1102090366

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1102090360 1102090366
Species Human (GRCh38) Human (GRCh38)
Location 12:110182246-110182268 12:110182284-110182306
Sequence CCACCCAGCTATAGCTTCTATAG CAATTTCTAGGAAAACTTATAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 98} {0: 1, 1: 0, 2: 0, 3: 17, 4: 238}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!