ID: 1102099957_1102099970

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1102099957 1102099970
Species Human (GRCh38) Human (GRCh38)
Location 12:110270579-110270601 12:110270605-110270627
Sequence CCCCCCCCCCTTTTTTTTTCTAT GGGACATCAAGGGAGCAAGCTGG
Strand - +
Off-target summary {0: 2, 1: 14, 2: 269, 3: 1423, 4: 5634} {0: 1, 1: 0, 2: 2, 3: 20, 4: 200}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!