|
Left Crispr |
Right Crispr |
| Crispr ID |
1102119627 |
1102119634 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
12:110429993-110430015
|
12:110430014-110430036
|
| Sequence |
CCCTCCTCTTCCTACTTCTCCAG |
AGTTTTTTGGGTCTGCCCCTTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 3, 2: 12, 3: 191, 4: 1414} |
{0: 4, 1: 2, 2: 1, 3: 8, 4: 124} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|