ID: 1102119627_1102119643

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1102119627 1102119643
Species Human (GRCh38) Human (GRCh38)
Location 12:110429993-110430015 12:110430045-110430067
Sequence CCCTCCTCTTCCTACTTCTCCAG CTGGAGTTATGGTGGTTTTCCGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 12, 3: 191, 4: 1414} {0: 1, 1: 1, 2: 4, 3: 12, 4: 129}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!