ID: 1102142617_1102142621

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1102142617 1102142621
Species Human (GRCh38) Human (GRCh38)
Location 12:110628022-110628044 12:110628058-110628080
Sequence CCTGCTTCCTTCTCTCTCTTCTG TTACTCCAGGACTTTCACGGTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 24, 3: 222, 4: 1808} {0: 1, 1: 0, 2: 0, 3: 2, 4: 82}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!