ID: 1102173968_1102173971

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1102173968 1102173971
Species Human (GRCh38) Human (GRCh38)
Location 12:110862461-110862483 12:110862478-110862500
Sequence CCAGCCGTTGCCTTGGAGAATGT GAATGTCTCCCATTGTGCAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 69} {0: 1, 1: 0, 2: 1, 3: 27, 4: 197}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!