ID: 1102201125_1102201137

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1102201125 1102201137
Species Human (GRCh38) Human (GRCh38)
Location 12:111058677-111058699 12:111058729-111058751
Sequence CCTTGCAGATAGTGGTGTTACAG CTCACGCAAGAAAGAATTCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 107} {0: 62, 1: 362, 2: 564, 3: 763, 4: 898}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!