ID: 1102202372_1102202383

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1102202372 1102202383
Species Human (GRCh38) Human (GRCh38)
Location 12:111066531-111066553 12:111066581-111066603
Sequence CCTTACCTCTGCCTGGAGCTGGA ACCCATTGGGTGAGGGGTGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 341} {0: 1, 1: 0, 2: 3, 3: 19, 4: 229}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!