ID: 1102203791_1102203795

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1102203791 1102203795
Species Human (GRCh38) Human (GRCh38)
Location 12:111076363-111076385 12:111076406-111076428
Sequence CCTACCATGTAGAGATGACCTAG GCATTCTTGTTCCCATTTGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 96} {0: 1, 1: 0, 2: 1, 3: 28, 4: 249}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!