ID: 1102204993_1102205000

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1102204993 1102205000
Species Human (GRCh38) Human (GRCh38)
Location 12:111084146-111084168 12:111084192-111084214
Sequence CCTTACAAATAAATATGATTTTC CTGAATCAGCAGGAGTGGAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 38, 4: 672} {0: 1, 1: 0, 2: 7, 3: 66, 4: 552}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!