ID: 1102232902_1102232909

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1102232902 1102232909
Species Human (GRCh38) Human (GRCh38)
Location 12:111275827-111275849 12:111275840-111275862
Sequence CCACCAGCTCTCCCCTTTGAACC CCTTTGAACCTCAGGAGAGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 24, 4: 284} {0: 1, 1: 0, 2: 2, 3: 19, 4: 257}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!