ID: 1102233117_1102233126

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1102233117 1102233126
Species Human (GRCh38) Human (GRCh38)
Location 12:111277226-111277248 12:111277246-111277268
Sequence CCTCCCAGCCTGCGCAGGGAGGG GGGGAAAGGAGATTGGCACTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 44, 4: 463} {0: 1, 1: 1, 2: 14, 3: 38, 4: 366}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!