ID: 1102240676_1102240691

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1102240676 1102240691
Species Human (GRCh38) Human (GRCh38)
Location 12:111322684-111322706 12:111322729-111322751
Sequence CCTGCTGCCCTGGCTTTCATCCC GAACATGGCGGGGGGTCCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 41, 4: 421} {0: 1, 1: 0, 2: 1, 3: 12, 4: 156}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!