ID: 1102253975_1102253984

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1102253975 1102253984
Species Human (GRCh38) Human (GRCh38)
Location 12:111405784-111405806 12:111405812-111405834
Sequence CCTCATGGCCCGCCCCTCCAGCC TCCGACTCGCGCGCGGCCTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 51, 4: 491} {0: 1, 1: 0, 2: 0, 3: 1, 4: 45}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!