ID: 1102254332_1102254356

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1102254332 1102254356
Species Human (GRCh38) Human (GRCh38)
Location 12:111407031-111407053 12:111407083-111407105
Sequence CCCCTTCCCTCCCTTCCCTCCCT GGGGACTGCATTTGAGGAACTGG
Strand - +
Off-target summary {0: 4, 1: 43, 2: 305, 3: 1834, 4: 8908} {0: 1, 1: 0, 2: 4, 3: 14, 4: 170}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!