ID: 1102256639_1102256649

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1102256639 1102256649
Species Human (GRCh38) Human (GRCh38)
Location 12:111418932-111418954 12:111418984-111419006
Sequence CCTGGGGAGAGCGCGGGCTGGGG CAGAGTGTCCAGAGGGAACTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 43, 4: 524} {0: 1, 1: 0, 2: 6, 3: 25, 4: 226}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!