ID: 1102287826_1102287828

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1102287826 1102287828
Species Human (GRCh38) Human (GRCh38)
Location 12:111673615-111673637 12:111673641-111673663
Sequence CCAAATAATAATAATAATAATAT ATAGTTAGATCCCATCTAATGGG
Strand - +
Off-target summary {0: 5, 1: 134, 2: 289, 3: 788, 4: 2998} {0: 1, 1: 0, 2: 0, 3: 10, 4: 94}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!