ID: 1102295036_1102295048

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1102295036 1102295048
Species Human (GRCh38) Human (GRCh38)
Location 12:111729905-111729927 12:111729935-111729957
Sequence CCCTCCATCTTCCCCGTCAGCAG CAGTGGTGCACGGGGACTTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 305} {0: 1, 1: 0, 2: 0, 3: 13, 4: 88}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!