ID: 1102297447_1102297450

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1102297447 1102297450
Species Human (GRCh38) Human (GRCh38)
Location 12:111747943-111747965 12:111747956-111747978
Sequence CCCAGAGTCAAAGGTTCACCTGA GTTCACCTGATTCCAAGGCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 139} {0: 1, 1: 0, 2: 1, 3: 12, 4: 179}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!