ID: 1102305006_1102305011

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1102305006 1102305011
Species Human (GRCh38) Human (GRCh38)
Location 12:111798226-111798248 12:111798246-111798268
Sequence CCATCGCCAAGGAGGAGGTGAGC AGCACTTGGGGCCAGTGCTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 145} {0: 1, 1: 0, 2: 1, 3: 12, 4: 175}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!