ID: 1102305285_1102305297

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1102305285 1102305297
Species Human (GRCh38) Human (GRCh38)
Location 12:111800075-111800097 12:111800114-111800136
Sequence CCAGCAGCCCCTCACAACCCAAC CAGGGCCTACTGGAATCTGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 50, 4: 423} {0: 1, 1: 0, 2: 8, 3: 52, 4: 457}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!