ID: 1102305287_1102305297

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1102305287 1102305297
Species Human (GRCh38) Human (GRCh38)
Location 12:111800083-111800105 12:111800114-111800136
Sequence CCCTCACAACCCAACAGAGATTC CAGGGCCTACTGGAATCTGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 141} {0: 1, 1: 0, 2: 8, 3: 52, 4: 457}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!