ID: 1102306320_1102306328

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1102306320 1102306328
Species Human (GRCh38) Human (GRCh38)
Location 12:111807379-111807401 12:111807416-111807438
Sequence CCCACTTCCCAGTGGGTACACTT GCAGAGTCCACAACAGCAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 130} {0: 1, 1: 0, 2: 4, 3: 17, 4: 232}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!