|
Left Crispr |
Right Crispr |
| Crispr ID |
1102397620 |
1102397624 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
12:112600803-112600825
|
12:112600840-112600862
|
| Sequence |
CCGTCCTCATGCTGCTAATAAAG |
TGATAATTTATAAAGAAAAGAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 6, 1: 402, 2: 665, 3: 2357, 4: 2399} |
{0: 11, 1: 582, 2: 5531, 3: 11034, 4: 9341} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|