ID: 1102428270_1102428273

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1102428270 1102428273
Species Human (GRCh38) Human (GRCh38)
Location 12:112861687-112861709 12:112861711-112861733
Sequence CCTTAGCTTCTAGTGTAACTGGG GGAGTCATTAAGAATATCCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 251, 4: 4738} {0: 1, 1: 0, 2: 0, 3: 15, 4: 137}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!