ID: 1102436117_1102436127

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1102436117 1102436127
Species Human (GRCh38) Human (GRCh38)
Location 12:112925316-112925338 12:112925355-112925377
Sequence CCTTGCACACCCCTCACGCCTGT CCCCTCTCCCAGCCAACCGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 263} {0: 1, 1: 0, 2: 1, 3: 33, 4: 344}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!