ID: 1102438918_1102438927

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1102438918 1102438927
Species Human (GRCh38) Human (GRCh38)
Location 12:112946703-112946725 12:112946733-112946755
Sequence CCTTCTTCCTTCTGAGTCCCCTG CCTCTCACAGGTGTGCCTACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 64, 4: 592} {0: 1, 1: 0, 2: 0, 3: 10, 4: 119}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!