ID: 1102443896_1102443902

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1102443896 1102443902
Species Human (GRCh38) Human (GRCh38)
Location 12:112986639-112986661 12:112986662-112986684
Sequence CCTGTCTTCAGGTTCCCTAATGG TGTGTGCAGGTGCTGGCCGCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 34, 4: 258} {0: 1, 1: 0, 2: 2, 3: 23, 4: 239}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!