ID: 1102444358_1102444360

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1102444358 1102444360
Species Human (GRCh38) Human (GRCh38)
Location 12:112990372-112990394 12:112990399-112990421
Sequence CCAGGTCATAGATGGTTATAAAG CCTGATTAGCAGTTAGTTGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 36, 4: 296} {0: 1, 1: 0, 2: 0, 3: 17, 4: 131}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!