ID: 1102445853_1102445857

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1102445853 1102445857
Species Human (GRCh38) Human (GRCh38)
Location 12:113002295-113002317 12:113002332-113002354
Sequence CCATCTCTAGAGACTTAACCACG AGCACAGCTGTGCCAAAACCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 68} {0: 1, 1: 0, 2: 0, 3: 20, 4: 199}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!