ID: 1102453036_1102453047

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1102453036 1102453047
Species Human (GRCh38) Human (GRCh38)
Location 12:113055808-113055830 12:113055855-113055877
Sequence CCACCCAGGCTGGAGTTCCCGGA AAACACCCCCAGGCCCCAGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 31, 4: 633} {0: 1, 1: 1, 2: 4, 3: 41, 4: 331}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!