ID: 1102453474_1102453486

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1102453474 1102453486
Species Human (GRCh38) Human (GRCh38)
Location 12:113057423-113057445 12:113057449-113057471
Sequence CCCTCTCCCCTCTTGTCTCCTGG GTCGCGAGCACGAGTGGGGTGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 6, 3: 68, 4: 717} {0: 1, 1: 0, 2: 0, 3: 1, 4: 30}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!